View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1962_low_11 (Length: 240)
Name: NF1962_low_11
Description: NF1962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1962_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 8139438 - 8139661
Alignment:
| Q |
1 |
cctttcgaccgtactcttttctggtgggagccctatgctcattgaacaggtaaccttcaaaatcaaaactttatggaattcacatattcactcacaacca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8139438 |
cctttcgaccgtactcttttctggtgggagccctatgctcattgaacaggtaaccttcaaaatcaaaactttatggaattcacatattcactcacaacca |
8139537 |
T |
 |
| Q |
101 |
taaatgagttttaactctgattgttctaaca--ggtcgtcgctctctgggaacatcatggcaagaacaagtgcagaagcaagtgccgggcagggaaagtc |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8139538 |
taaatgagttttaactctgattgttctaacagtggtcgtcgctctctgggaacatcatggcaagaacaagtgcagaagcaagtgccgggcagggaaagtc |
8139637 |
T |
 |
| Q |
199 |
acatctagtgtcatggaaaataat |
222 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
8139638 |
acatctagtgtcatggaaaataat |
8139661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 34 - 218
Target Start/End: Complemental strand, 7499230 - 7499040
Alignment:
| Q |
34 |
tatgctcattgaacaggtaaccttcaaaatcaaaactttatggaattcacatattcactcacaaccataaatgagttttaactctgattgttctaaca-- |
131 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||| | |||||||||||||||| |
|
|
| T |
7499230 |
tatgctaaatgaacaggtaaccttcaaaatcaaaactttatggaattcacatat----tcacaaccataaacgagtttttattctgattgttctaacagt |
7499135 |
T |
 |
| Q |
132 |
ggtcgtcgctctc--------tgggaacatcatggcaagaacaagtgcagaagcaagtgccgggcagggaaagtcacatctagtgtcatggaaaa |
218 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||||||||||||| |||| ||||| || ||||| |||||| |||||||||||| |
|
|
| T |
7499134 |
ggtcgtcgctctctgattgtgtgggaatatcatggcaagaacaagtgcagaagaaagttccgggtgggtaaagtggcatctaatgtcatggaaaa |
7499040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 13 - 87
Target Start/End: Complemental strand, 7502297 - 7502223
Alignment:
| Q |
13 |
actcttttctggtgggagccctatgctcattgaacaggtaaccttcaaaatcaaaactttatggaattcacatat |
87 |
Q |
| |
|
|||||||||||||| | |||||||| ||||||| |||||| ||||||||||| |||||||| |||||||||||| |
|
|
| T |
7502297 |
actcttttctggtgagggccctatgtgcattgaagaggtaaacttcaaaatcagaactttattgaattcacatat |
7502223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 160 - 218
Target Start/End: Complemental strand, 7502172 - 7502114
Alignment:
| Q |
160 |
aagaacaagtgcagaagcaagtgccgggcagggaaagtcacatctagtgtcatggaaaa |
218 |
Q |
| |
|
||||||||||||||||||||| || ||| |||||||| || ||||||||||||||||| |
|
|
| T |
7502172 |
aagaacaagtgcagaagcaagcaccaggcggggaaagtgacgtctagtgtcatggaaaa |
7502114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University