View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1962_low_6 (Length: 355)
Name: NF1962_low_6
Description: NF1962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1962_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 31 - 249
Target Start/End: Original strand, 26298600 - 26298818
Alignment:
| Q |
31 |
tgagatgaaacaaggtcgaatcattgttgtacactgcaactgcgatgatgatgaaataagttagtttttagtaagcaattctcagttcctgctgctgctc |
130 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26298600 |
tgagatgaaacaacgtcgaatcattgttgtacactgcaactgcgatgatgatgaaataatttagtttttagtaagcaattctcagttcctgctgctgctc |
26298699 |
T |
|
| Q |
131 |
tgctgtccagcgggtctcagtttagctgtgtttccatttgttttctattttgagctttagtctatacactgagatccttgtgtgtgcacttgcaagtgtt |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
26298700 |
tgctgtccagcgggtctcagtttagctgtgtttccatttgttttctattttgagctttagtctatacactgagctccttgtatgtgcacttgcaagtgtt |
26298799 |
T |
|
| Q |
231 |
taataaacttagctattaa |
249 |
Q |
| |
|
|||||||||||||| |||| |
|
|
| T |
26298800 |
taataaacttagcttttaa |
26298818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 49 - 159
Target Start/End: Original strand, 26278858 - 26278965
Alignment:
| Q |
49 |
aatcattgttgtacactgcaactgcgatgatgatgaaataagttagtttttagtaagcaattctcagttcctgctgctgctctgctgtccagcgggtctc |
148 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
26278858 |
aatcattgttgtgcactgcaactgcaatgatgatgaaataagttagtttttagtaagcaattctcagttc---ctgctgctctgctgtccaacgggtctc |
26278954 |
T |
|
| Q |
149 |
agtttagctgt |
159 |
Q |
| |
|
||||| ||||| |
|
|
| T |
26278955 |
agtttcgctgt |
26278965 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University