View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1962_low_8 (Length: 314)
Name: NF1962_low_8
Description: NF1962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1962_low_8 |
 | |
|
| [»] scaffold0006 (1 HSPs) |
| | |
|
| [»] scaffold0291 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 228; Significance: 1e-126; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 18 - 305
Target Start/End: Complemental strand, 13410928 - 13410644
Alignment:
| Q |
18 |
aaaaatctactgaaaaataaataaattaatcttggcagtggaacacatgattcatgattgcacgttttcaaataaatatgatattaatgggttccagttt |
117 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13410928 |
aaaaatctactgaaaaataaattaattaatcttggcagtggaacacatgattcatgattgcacgttttcaaataaatatgatattaatgggttccagttt |
13410829 |
T |
|
| Q |
118 |
cttccatatagcttaagcagaattactttttcactttccaccacaaactccactcacaatcacattttttggtcgttaataaattgannnnnnnncttga |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| || | |
|
|
| T |
13410828 |
gttccatatagcttaagcagaattactttttcactttccaccacaaactccactcacaatcacattttctggtcgttaataaattgatttttt---ttca |
13410732 |
T |
|
| Q |
218 |
agtagtctagtgactaaattcatacatataatgtgtgaagaagttggcaatccgaaatttaaattctgacccctatacataatatctc |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||| ||||||||||||||||||||| |
|
|
| T |
13410731 |
agtagtctagtgactaaattcatacatataatgtgtgaagaagttggcaatctggaatttaaattccgacccctatacataatatctc |
13410644 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 142 - 181
Target Start/End: Complemental strand, 13487881 - 13487842
Alignment:
| Q |
142 |
actttttcactttccaccacaaactccactcacaatcaca |
181 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
13487881 |
actttttcactttccaccataaactccactcacaatcaca |
13487842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 70 - 113
Target Start/End: Complemental strand, 13602916 - 13602873
Alignment:
| Q |
70 |
catgattgcacgttttcaaataaatatgatattaatgggttcca |
113 |
Q |
| |
|
||||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
13602916 |
catgattgcacattttcaaataaatataatattaatgggttcca |
13602873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0006 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0006
Description:
Target: scaffold0006; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 70 - 113
Target Start/End: Complemental strand, 131573 - 131530
Alignment:
| Q |
70 |
catgattgcacgttttcaaataaatatgatattaatgggttcca |
113 |
Q |
| |
|
||||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
131573 |
catgattgcacattttcaaataaatataatattaatgggttcca |
131530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0291 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0291
Description:
Target: scaffold0291; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 54 - 90
Target Start/End: Original strand, 20799 - 20835
Alignment:
| Q |
54 |
agtggaacacatgattcatgattgcacgttttcaaat |
90 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
20799 |
agtggatcacatgattcatgattgcacattttcaaat |
20835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University