View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19630_high_11 (Length: 393)

Name: NF19630_high_11
Description: NF19630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19630_high_11
NF19630_high_11
[»] chr8 (2 HSPs)
chr8 (19-233)||(39044839-39045053)
chr8 (292-379)||(39045112-39045199)
[»] chr7 (1 HSPs)
chr7 (138-213)||(40022292-40022367)


Alignment Details
Target: chr8 (Bit Score: 211; Significance: 1e-115; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 19 - 233
Target Start/End: Original strand, 39044839 - 39045053
Alignment:
19 attgggcggttacgagattggttgatgagaggttgatggccgattggatgagttggagagcggtgggatttggagggagattggcgagtgatgattcgca 118  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39044839 attgggcggttacgagattggtagatgagaggttgatggccgattggatgagttggagagcggtgggatttggagggagattggcgagtgatgattcgca 39044938  T
119 ttgttgtgggaatcgggttgctttgcaggcttgttggatctctgacccggcggtgggagaaacggagggggagggagtaggttggtggtgattgtggttg 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39044939 ttgttgtgggaatcgggttgctttgcaggcttgttggatctctgacccggcggtgggagaaacggagggggagggagtaggttggtggtgattgtggttg 39045038  T
219 tgatggtgagtggcg 233  Q
    |||||||||||||||    
39045039 tgatggtgagtggcg 39045053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 292 - 379
Target Start/End: Original strand, 39045112 - 39045199
Alignment:
292 tggttattgcgagtttaatgggtttgttcatggttgtgattttattttatacagcaaatgtgtatgtttggtcgtaatggagtattat 379  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
39045112 tggttattgcgagtttaatgggtttattcatggttgtgattttattttatacagcaactgtgtatgtttggtcgtaatggagtattat 39045199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 138 - 213
Target Start/End: Original strand, 40022292 - 40022367
Alignment:
138 gctttgcaggcttgttggatctctgacccggcggtgggagaaacggagggggagggagtaggttggtggtgattgt 213  Q
    ||||||||||||||||| ||||| ||| |||| |||||| |||||||||| || |||||  || ||||||| ||||    
40022292 gctttgcaggcttgttgaatctccgacgcggccgtgggataaacggagggagaaggagtgcgtgggtggtggttgt 40022367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University