View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19630_high_14 (Length: 386)
Name: NF19630_high_14
Description: NF19630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19630_high_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 162; Significance: 2e-86; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 17 - 182
Target Start/End: Original strand, 18418428 - 18418593
Alignment:
| Q |
17 |
aaaagagtgataatggaataatgaatgatatgaaaagagaaggtaagagatgaagaatgtgatgatgaggggttggaaaggagggaagtggggttttata |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18418428 |
aaaagagtgataatggaataatgaatgatatgaaaagagaaggtaagagatgaaggatgtgatgatgaggggttggaaaggagggaagtggggttttata |
18418527 |
T |
 |
| Q |
117 |
aactgtgtggatggatagtggggacaggacaggtaaaggagaacttgtaacatggggaggttggaa |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18418528 |
aactgtgtggatggatagtggggacaggacaggtaaaggagaacttgtaacatggggaggttggaa |
18418593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 116; E-Value: 6e-59
Query Start/End: Original strand, 181 - 371
Target Start/End: Original strand, 18418634 - 18418829
Alignment:
| Q |
181 |
aaattaaatgagaggaggcacactttaggattcaactatctgcttttaaatttgggttggtctaactt-----gtacaaaatcgacttgaaagatgatga |
275 |
Q |
| |
|
||||||||| ||||||| || || |||||||||||||||||||||||||||| |||||||||||| ||| ||||| |||||||||||||||| |
|
|
| T |
18418634 |
aaattaaataagaggagagacgattcaggattcaactatctgcttttaaatttgagttggtctaactcaactcgtataaaattaacttgaaagatgatga |
18418733 |
T |
 |
| Q |
276 |
ttgattttattttgtagatcacatcacatttaatatgaaatttttaacaattttcgtcaactgcggttgggcgaaggatatcatttagtatgaaac |
371 |
Q |
| |
|
||||||| ||||||||||||| |||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
18418734 |
ttgatttcattttgtagatcatatcatatttaatatgaaatttttaacaattttcgtcaattgcggttgggcgaaggatatcatttagtatgaaac |
18418829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University