View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19630_high_16 (Length: 374)
Name: NF19630_high_16
Description: NF19630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19630_high_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 358; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 358; E-Value: 0
Query Start/End: Original strand, 1 - 358
Target Start/End: Original strand, 25885134 - 25885491
Alignment:
| Q |
1 |
acggcgacctcaaaccctctaatatcctcctcgacacagacttccaacccctcatttctgatttcggtctaaaccggctaatcagcattaccggcaacaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25885134 |
acggcgacctcaaaccctctaatatcctcctcgacacagacttccaacccctcatttctgatttcggtctaaaccggctaatcagcattaccggcaacaa |
25885233 |
T |
 |
| Q |
101 |
tccctcgaccggcggttttatgggtggagctcttccttacatgaagtcatcgcaaacagaacgaaccaacaactataaagctcctgaagctaaagtacca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25885234 |
tccctcgaccggcggttttatgggtggagctcttccttacatgaagtcatcgcaaacagaacgaaccaacaactataaagctcctgaagctaaagtacca |
25885333 |
T |
 |
| Q |
201 |
ggctgcagacccacccaaaaatgggatgtgtattcatttggtgttgtgttacttgaattgctcaccggtaagtccccagattcttccccaggagcatcga |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25885334 |
ggctgcagacccacccaaaaatgggatgtgtattcatttggtgttgtgttacttgaattgctcaccggtaagtccccagattcttccccaggagcatcga |
25885433 |
T |
 |
| Q |
301 |
cttctgtcgaagtgcctgacttggtaaggtgggtaaagaaagggtttgaacaagaaag |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25885434 |
cttctgtcgaagtgcctgacttggtaaggtgggtaaagaaagggtttgaacaagaaag |
25885491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University