View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19630_high_33 (Length: 215)
Name: NF19630_high_33
Description: NF19630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19630_high_33 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 26 - 214
Target Start/End: Original strand, 1801793 - 1801985
Alignment:
| Q |
26 |
tttctgctcaattaaatgcacaatttgtagttccttttttattttgtatgcgttgattgattc----attctatggaactttgaatcccctttaactttt |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
1801793 |
tttctgctcaattaaatgcacaatttgtagttccttttttattttgtatgcgttgattgattcattcattctatggaactttgaatcccctttaactttt |
1801892 |
T |
 |
| Q |
122 |
aagctattttggatgtttatttctagctttctacatgttccaaaaatatggattttatcatgttttactcttaggctttgtttgggagtttta |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1801893 |
aagctattttggatgtttatttctagctttctacatgttccaaaaatatggattttatcatgttttactcttaggctttgtttgggagtttta |
1801985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University