View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19630_high_4 (Length: 540)
Name: NF19630_high_4
Description: NF19630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19630_high_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 102; Significance: 2e-50; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 5 - 106
Target Start/End: Complemental strand, 1521985 - 1521884
Alignment:
| Q |
5 |
aatgatatttacatatgcatatccattttgtgtaccatatctaagataaacgtttgattttatatggtggtttacaatctacttgaggaaacctgaattt |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1521985 |
aatgatatttacatatgcatatccattttgtgtaccatatctaagataaacgtttgattttatatggtggtttacaatctacttgaggaaacctgaattt |
1521886 |
T |
|
| Q |
105 |
aa |
106 |
Q |
| |
|
|| |
|
|
| T |
1521885 |
aa |
1521884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University