View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19631_high_105 (Length: 225)

Name: NF19631_high_105
Description: NF19631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19631_high_105
NF19631_high_105
[»] chr3 (2 HSPs)
chr3 (110-206)||(48393444-48393540)
chr3 (10-46)||(48393539-48393575)


Alignment Details
Target: chr3 (Bit Score: 97; Significance: 8e-48; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 110 - 206
Target Start/End: Complemental strand, 48393540 - 48393444
Alignment:
110 atcgacaatgctacttttctatctgataaggaggctgcaattcctgatcatgatctcgaagctgctgcagacatggatgaagatttggattgtattt 206  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48393540 atcgacaatgctacttttctatctgataaggaggctgcaattcctgatcatgatctcgaagctgctgcagacatggatgaagatttggattgtattt 48393444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 10 - 46
Target Start/End: Complemental strand, 48393575 - 48393539
Alignment:
10 tcgaagaatataaaaatgaaattcataatgtgattat 46  Q
    ||||| || ||||||||||||||||||||||||||||    
48393575 tcgaaaaaaataaaaatgaaattcataatgtgattat 48393539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University