View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19631_high_35 (Length: 419)
Name: NF19631_high_35
Description: NF19631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19631_high_35 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 366; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 366; E-Value: 0
Query Start/End: Original strand, 9 - 406
Target Start/End: Original strand, 44086224 - 44086621
Alignment:
| Q |
9 |
ttcttgtttgggaactgttaaatggtcgcgtcaggctcatggggtggcaactatagttggatttcgcacgcatttgattctcaacaatgctttgattgac |
108 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
44086224 |
ttcttgtttggatactgttaaatggttgcgtcaggttcatggggtggcaactatagttggatttcgcacgaatttgattctcaacaatgctttgattgac |
44086323 |
T |
 |
| Q |
109 |
gcttatgggaaatgtggggaacccaattcctcgttttgtttgtttcgttcgatggtagagaaagatgtagtgtcttggacatcaatggtagttacataca |
208 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
44086324 |
gcttatgggaaatgtggggaacccaattcatcgttttgtttgtttcgttcgatggtagagaaagatgcagtgtcttggacatctatggtagttacataca |
44086423 |
T |
 |
| Q |
209 |
caagagcatcgaggattgatgatgcatgcaaggtgtttaatgaaatgccagttaaatacacggtttcttgggctgctttgatctcgggtttcgttaaaaa |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44086424 |
caagagcatcgaggattgatgatgcatgcaaggtgtttaatgaaatgccagttaaatacacggtttcttgggctgctttgatctcgggtttcgttaaaaa |
44086523 |
T |
 |
| Q |
309 |
tggacgctgttatgaagctttagaagtgtttcaccaaatgattaaagaaggggtactgcctagggcacagacttttgtaagtgttttagatgcttgtg |
406 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44086524 |
tggacgctgttatgaagctttagaagtgtttcaccaaatgattaaagaaggggtactgcctagggcacagacttttgtaagtgttttagatgcttgtg |
44086621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University