View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19631_high_48 (Length: 355)
Name: NF19631_high_48
Description: NF19631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19631_high_48 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 322; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 11 - 336
Target Start/End: Complemental strand, 48890434 - 48890109
Alignment:
| Q |
11 |
ttattctgaaattaaatcccaaacacgaacgcaactatcttctcccgaactgaccactctttctggctcaataaaagtcaagccatacactccacctaaa |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48890434 |
ttattctgaaattaaatcccaaacacgaacgcaactatcttctcccgaactgaccactctttctggctcaataaaagtcaagccatacactccacctaaa |
48890335 |
T |
 |
| Q |
111 |
tgagccccttttatggttctgcggcttgatgctggctttccaatttcgtatacaataacacatgtatcaagtgaaccagtagctaccagtttgctattag |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48890334 |
tgagccccttttatggttctgcggcttgatgctggctttccaatttcgtatacaataacacatgtatcaagtgaaccagtagctaccagtttgctattag |
48890235 |
T |
 |
| Q |
211 |
gtgaccaagcaagacagtttacacgtgcagtgtgaaacaacatgttattaagcaccacctgaaagagaaaggaagatttatttagcaacggcatttttca |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
48890234 |
gtgaccaagcaagacagtttacacgtgcagtgtgaaacaacatgttattaagcaccacctgaaagagaaaggaagatttatttagcaacgacatttttca |
48890135 |
T |
 |
| Q |
311 |
gtaagttatgacaaaaacaagtgtac |
336 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
48890134 |
gtaagttatgacaaaaacaagtgtac |
48890109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University