View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19631_high_72 (Length: 282)
Name: NF19631_high_72
Description: NF19631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19631_high_72 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 253
Target Start/End: Original strand, 45691317 - 45691567
Alignment:
| Q |
1 |
atcaaaataattagctgaagatttaaaaggtctacgaacaaggtttgattaatcaggaagttaaatcagacctcaaaaaagcataatattctgctcctat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||| || |
|
|
| T |
45691317 |
atcaaaataattagctgaagatttaaaaggtctacgaacaagctttgattaatcaggaagttaaatcagacctcaaaaaagcagaatattctgctccaat |
45691416 |
T |
|
| Q |
101 |
cagtattgaggaaaaagttgctacaaatgatgataaggagcacttgatcctctgctaaaggatcttcaagagaggcagatgatgaaatcaaaaagattga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
45691417 |
cagtattgaggaaaaagttgctacaaatgatgataaggagcacttgatc--ctgctaaaggatcttcaagagaggcagatgatgaaatcaagaagattga |
45691514 |
T |
|
| Q |
201 |
ggcaatgacatctgcaaatgaagtgggcgatgtgaaggctgagaatttaagag |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
45691515 |
ggcaatgacatctgcaaatgaagtgggcgatgtgaaggctgagagtgtaagag |
45691567 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University