View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19631_high_74 (Length: 282)
Name: NF19631_high_74
Description: NF19631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19631_high_74 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 132 - 252
Target Start/End: Complemental strand, 33539385 - 33539264
Alignment:
| Q |
132 |
gttagtattgggcgcaca-atttaaaaatgcaaagtgcaatgctataacaaagttagcattgactcacacataatcatagacttatattttatagtttct |
230 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33539385 |
gttagtattgggcgcacacatttaaaaatgcaaagtgcaatgctataacaaagttagcattgactcacacataatcatagacttatattttatagtttct |
33539286 |
T |
|
| Q |
231 |
ggatttaggcaaataaactttg |
252 |
Q |
| |
|
|||||||||||| ||||||||| |
|
|
| T |
33539285 |
ggatttaggcaagtaaactttg |
33539264 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 1 - 109
Target Start/End: Complemental strand, 33539708 - 33539600
Alignment:
| Q |
1 |
caatacaatcggataagtacgcccttagtatgtcttgaagaagaaatggtgaatatgtagtaaaatttgaaaattacataataatttcactaaaatccat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
33539708 |
caatacaatcggataagtacgcccttagtatgtcttgaagaagaaatggtgaatatgtagtaacatttgaaaattacataagaatttcactaaaatccat |
33539609 |
T |
|
| Q |
101 |
ttaagaccc |
109 |
Q |
| |
|
||||||||| |
|
|
| T |
33539608 |
ttaagaccc |
33539600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University