View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19631_high_83 (Length: 260)
Name: NF19631_high_83
Description: NF19631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19631_high_83 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 55 - 206
Target Start/End: Complemental strand, 48650775 - 48650623
Alignment:
| Q |
55 |
ggtacaagactaaatatgcccctttacaaaaggtgatttttgaccatacttgaaaatttgttaattcataaatgtgatccttcattcctttttcaatttt |
154 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48650775 |
ggtataagactaaatatgcccctttacaaaaggtgatttttgaccatacttgaaaatttgttaattcataaatgtgatccttcattcctttttcaatttt |
48650676 |
T |
|
| Q |
155 |
ttacataaggtatcaactttgggcgagggg-gtttaaagggaggttgtagata |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
48650675 |
ttacataaggtatcaactttgggcgaggggagtttaaagggaggttgtagata |
48650623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University