View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19631_high_89 (Length: 250)
Name: NF19631_high_89
Description: NF19631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19631_high_89 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 20 - 235
Target Start/End: Complemental strand, 50808414 - 50808199
Alignment:
| Q |
20 |
aaaacggactactagcaatatggtgattttatgcaaaagaaaaaagaatgcatttgtgtgatccgcaaacaaagcaaaaataactaatatgtgtgacaat |
119 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50808414 |
aaaacggtctactagcaatatggtgattttatgcaaaagaaaaaagaatgcatttgtgtgatccgcaaacaaagcaaaaataactaatatgtgtgacaat |
50808315 |
T |
 |
| Q |
120 |
ttaagctaggtgataccttcaaagaaacacccaggaaaggacaatcaaatatagactgcaaaattgaagttttgatattataagcagccccaaatccaat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50808314 |
ttaagctaggtgataccttcaaagaaacacccaggaaaggacaatcaaatatagactgcaaaattgaagttttgatattataagcagccccaaatccaat |
50808215 |
T |
 |
| Q |
220 |
tctggcttctttataa |
235 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
50808214 |
tctggcttctttataa |
50808199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University