View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19631_low_100 (Length: 241)
Name: NF19631_low_100
Description: NF19631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19631_low_100 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 1e-93; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 60 - 241
Target Start/End: Complemental strand, 26642142 - 26641961
Alignment:
| Q |
60 |
tttatagatagtttagtcagctaggttgttatgttgttgttttgatcccattgccaatatagattagatatatatagtatccaacgactgctaagcttac |
159 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
26642142 |
tttatagatagtttagtcagttaggttgttatgttgttgttttgatcccattgccaatatagattagatatatatagtatccaatgactgctaagcttac |
26642043 |
T |
 |
| Q |
160 |
ttagtaaatccctacattcatgtgatatttgtttctaacaattcccgttatgcttgtgttgcccccaaagaatcctaacatt |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26642042 |
ttagtaaatccctacattcatgtgatatttgtttctaacaattcccgttatgcttgtgttgcccccaaagaatcctaacatt |
26641961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 19 - 62
Target Start/End: Complemental strand, 26643269 - 26643226
Alignment:
| Q |
19 |
tgttggtgacacttaccctgctatggtgagcaatcttgtgattt |
62 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26643269 |
tgttggtgacacttaccctgctatggtgagcaatcttgtgattt |
26643226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University