View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19631_low_104 (Length: 238)
Name: NF19631_low_104
Description: NF19631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19631_low_104 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 4e-99; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 40 - 229
Target Start/End: Complemental strand, 32220040 - 32219850
Alignment:
| Q |
40 |
ttgttttaagtaatgaataattggttctgcaagtgtaatacttcaacaaggttgttcaattatttatataactt-ggggtggttttttgcaaaagaaaat |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
32220040 |
ttgttttaagtaatgaataattggttctgcaagtgtaatacttcaacaaggttgttcaattatttatataacttaggggtggttttttgcaaaagaaaat |
32219941 |
T |
 |
| Q |
139 |
atctatgaaaattgtgtggttgaagattttaacgtgggtctatcctatcgactcatacataaatattatagtaagaatacgtgtcctttga |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32219940 |
atctatgaaaattgtgtggttgaagattttaacgtgggtctatcctatcgactcatacataaatattatagtaagaatacgtgtcctttga |
32219850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 133 - 203
Target Start/End: Complemental strand, 32210061 - 32209993
Alignment:
| Q |
133 |
gaaaatatctatgaaaattgtgtggttgaagattttaacgtgggtctatcctatcgactcatacataaata |
203 |
Q |
| |
|
||||||||||||||| |||||| |||||||||||||| ||||||||| | |||| | ||| ||||||||| |
|
|
| T |
32210061 |
gaaaatatctatgaatattgtg--gttgaagattttaatgtgggtctaccttatctattcaaacataaata |
32209993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University