View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19631_low_109 (Length: 225)
Name: NF19631_low_109
Description: NF19631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19631_low_109 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 97; Significance: 8e-48; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 110 - 206
Target Start/End: Complemental strand, 48393540 - 48393444
Alignment:
| Q |
110 |
atcgacaatgctacttttctatctgataaggaggctgcaattcctgatcatgatctcgaagctgctgcagacatggatgaagatttggattgtattt |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48393540 |
atcgacaatgctacttttctatctgataaggaggctgcaattcctgatcatgatctcgaagctgctgcagacatggatgaagatttggattgtattt |
48393444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 10 - 46
Target Start/End: Complemental strand, 48393575 - 48393539
Alignment:
| Q |
10 |
tcgaagaatataaaaatgaaattcataatgtgattat |
46 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||| |
|
|
| T |
48393575 |
tcgaaaaaaataaaaatgaaattcataatgtgattat |
48393539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University