View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19631_low_116 (Length: 204)
Name: NF19631_low_116
Description: NF19631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19631_low_116 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 66; Significance: 2e-29; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 23187476 - 23187411
Alignment:
| Q |
1 |
tgaccccctacatgatgaccccctccatcagaaacaatgttattatcatattcataaacaatgcta |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23187476 |
tgaccccctacatgatgaccccctccatcagaaacaatgttattatcatattcataaacaatgcta |
23187411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 137 - 185
Target Start/End: Complemental strand, 23187413 - 23187365
Alignment:
| Q |
137 |
ctaattttatgctgttggcttttgagtcttatttacctgtagctttacc |
185 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23187413 |
ctaattatatgctgttggcttttgagtcttatttacctgtagctttacc |
23187365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 117 - 177
Target Start/End: Complemental strand, 23178813 - 23178753
Alignment:
| Q |
117 |
agagaaaaaatttcccatatctaattttatgctgttggcttttgagtcttatttacctgta |
177 |
Q |
| |
|
|||| ||||||||||||| ||| | |||| |||||||||||||||||||||| |||||| |
|
|
| T |
23178813 |
agagcaaaaatttcccatttctgtatatatgttgttggcttttgagtcttattttcctgta |
23178753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University