View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19631_low_25 (Length: 451)

Name: NF19631_low_25
Description: NF19631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19631_low_25
NF19631_low_25
[»] chr5 (1 HSPs)
chr5 (18-441)||(36871684-36872100)
[»] chr3 (3 HSPs)
chr3 (18-227)||(37629447-37629656)
chr3 (70-161)||(40296503-40296594)
chr3 (350-402)||(47187644-47187696)
[»] chr2 (1 HSPs)
chr2 (88-227)||(8926973-8927112)
[»] chr4 (1 HSPs)
chr4 (154-227)||(55528128-55528201)
[»] chr7 (4 HSPs)
chr7 (350-395)||(19267394-19267439)
chr7 (350-395)||(7754238-7754283)
chr7 (350-382)||(30969761-30969793)
chr7 (350-406)||(38602992-38603048)
[»] scaffold1625 (1 HSPs)
scaffold1625 (350-402)||(905-957)
[»] chr8 (1 HSPs)
chr8 (350-394)||(13866186-13866230)


Alignment Details
Target: chr5 (Bit Score: 308; Significance: 1e-173; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 18 - 441
Target Start/End: Complemental strand, 36872100 - 36871684
Alignment:
18 aacttttggcaccaaagtagccaactaccctcaatgcccaaatccagagctggtgaagggtcttcgtgctcacaccgatgccggaggaatcatccttctc 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36872100 aacttttggcaccaaagtagccaactaccctcaatgcccaaatccagagctggtgaagggtcttcgtgctcacaccgatgccggaggaatcatccttctc 36872001  T
118 ttccaggatgataaggtcagtggcctacaattgctcaaagatggccagtgggttgatgttcccccaatgcgccactccatcgttgtcaaccttggtgacc 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36872000 ttccaggatgataaggtcagtggcctacaattgctcaaagatggccagtgggttgatgttcccccaatgcgccactccatcgttgtcaaccttggtgacc 36871901  T
218 aacttgaggtnnnnnnnnnttcctttaccaagtcaactctcatttcaattctcaaacttnnnnnnnnnnnnnnnntccataat-agtccttgaattcggc 316  Q
    ||||||||||         ||||||||||||||||||||||||||||||||||||||||                || ||| | ||||||||||| | ||    
36871900 aacttgaggt-aaaaaaaattcctttaccaagtcaactctcatttcaattctcaaactt-------aaaaaaaaatctatattaagtccttgaatcctgc 36871809  T
317 tgctctaaagtgagcaacaaaccataagttgtttaacaacccttgattttttcactttacactttactcacgttagagggtctaaatcccgattatattg 416  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||    
36871808 tgctctaaagtgagcaacaaaccataagttgtttaacaacccttgattttctcactttacactttactcatgttagagggtctaaatcccgattatattg 36871709  T
417 acggatttgaatcctcctccctatg 441  Q
    |||||||||||||||||||||||||    
36871708 acggatttgaatcctcctccctatg 36871684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 82; Significance: 1e-38; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 18 - 227
Target Start/End: Original strand, 37629447 - 37629656
Alignment:
18 aacttttggcaccaaagtagccaactaccctcaatgcccaaatccagagctggtgaagggtcttcgtgctcacaccgatgccggaggaatcatccttctc 117  Q
    ||||||||| ||||| || || |||||||||| ||||||||| ||||| || || |||||||| ||||| |||||||||||||| ||||||||||||||     
37629447 aacttttggaaccaaggttgcaaactaccctccatgcccaaaaccagaccttgtaaagggtctccgtgcacacaccgatgccggtggaatcatccttctt 37629546  T
118 ttccaggatgataaggtcagtggcctacaattgctcaaagatggccagtgggttgatgttcccccaatgcgccactccatcgttgtcaaccttggtgacc 217  Q
    ||||| ||||| |||||||||||||| ||  | |||||||||||  | ||||| ||||| || || ||||  || ||||| ||  |||||||||||||||    
37629547 ttccaagatgacaaggtcagtggccttcagcttctcaaagatggtaactgggtagatgtccctcccatgcatcattccattgtcatcaaccttggtgacc 37629646  T
218 aacttgaggt 227  Q
    ||||||||||    
37629647 aacttgaggt 37629656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 70 - 161
Target Start/End: Original strand, 40296503 - 40296594
Alignment:
70 gtgaagggtcttcgtgctcacaccgatgccggaggaatcatccttctcttccaggatgataaggtcagtggcctacaattgctcaaagatgg 161  Q
    ||||| ||||| || |||||||| ||||| |||||  ||||||| || ||||| ||||| |||||  ||||||| ||| |||||||||||||    
40296503 gtgaatggtctccgagctcacactgatgcaggaggtgtcatcctactgttccaagatgacaaggtaggtggccttcaaatgctcaaagatgg 40296594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 350 - 402
Target Start/End: Complemental strand, 47187696 - 47187644
Alignment:
350 taacaacccttgattttttcactttacactttactcacgttagagggtctaaa 402  Q
    ||||||| ||| ||||| |||||||||||||||||| | ||||||| ||||||    
47187696 taacaactcttaattttctcactttacactttactcgctttagaggatctaaa 47187644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 48; Significance: 3e-18; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 88 - 227
Target Start/End: Original strand, 8926973 - 8927112
Alignment:
88 cacaccgatgccggaggaatcatccttctcttccaggatgataaggtcagtggcctacaattgctcaaagatggccagtgggttgatgttcccccaatgc 187  Q
    ||||| ||||| || || ||||||||||||||||| ||||| || |||||||| || ||  | |||||||||| ||| ||| ||||||| || |||||||    
8926973 cacacagatgctggtggcatcatccttctcttccaagatgacaaagtcagtggacttcagcttctcaaagatgaccaatggattgatgtccctccaatgc 8927072  T
188 gccactccatcgttgtcaaccttggtgaccaacttgaggt 227  Q
      ||||| || ||  |||||||||||||||||||||||||    
8927073 ctcactctattgtcatcaaccttggtgaccaacttgaggt 8927112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 154 - 227
Target Start/End: Original strand, 55528128 - 55528201
Alignment:
154 aaagatggccagtgggttgatgttcccccaatgcgccactccatcgttgtcaaccttggtgaccaacttgaggt 227  Q
    ||||||||||| ||| ||||||| || ||||||||||| ||||| ||| ||||||||||||||||| |||||||    
55528128 aaagatggccaatggattgatgtcccaccaatgcgccattccattgttatcaaccttggtgaccaaattgaggt 55528201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 34; Significance: 0.0000000006; HSPs: 4)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 350 - 395
Target Start/End: Original strand, 19267394 - 19267439
Alignment:
350 taacaacccttgattttttcactttacactttactcacgttagagg 395  Q
    ||||||||||||||||| ||| |||||||||||||||| |||||||    
19267394 taacaacccttgattttctcaatttacactttactcactttagagg 19267439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 350 - 395
Target Start/End: Original strand, 7754238 - 7754283
Alignment:
350 taacaacccttgattttttcactttacactttactcacgttagagg 395  Q
    ||||||||||||||||| ||| ||||||||| |||||| |||||||    
7754238 taacaacccttgattttctcattttacacttaactcactttagagg 7754283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 350 - 382
Target Start/End: Complemental strand, 30969793 - 30969761
Alignment:
350 taacaacccttgattttttcactttacacttta 382  Q
    ||||||||||||||||| |||||||||||||||    
30969793 taacaacccttgattttctcactttacacttta 30969761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 350 - 406
Target Start/End: Complemental strand, 38603048 - 38602992
Alignment:
350 taacaacccttgattttttcactttacactttactcacgttagagggtctaaatccc 406  Q
    ||||||||||||||||| |  |||||||||| |||||| ||||||| || |||||||    
38603048 taacaacccttgattttcttgctttacacttcactcactttagaggatccaaatccc 38602992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1625 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: scaffold1625
Description:

Target: scaffold1625; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 350 - 402
Target Start/End: Complemental strand, 957 - 905
Alignment:
350 taacaacccttgattttttcactttacactttactcacgttagagggtctaaa 402  Q
    ||||||| |||||||||||||||||||||||||| | | ||||||| ||||||    
957 taacaactcttgattttttcactttacactttacccgctttagaggatctaaa 905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 350 - 394
Target Start/End: Complemental strand, 13866230 - 13866186
Alignment:
350 taacaacccttgattttttcactttacactttactcacgttagag 394  Q
    ||||||||||||||||| | ||||||||||||| |||| ||||||    
13866230 taacaacccttgattttctgactttacactttattcactttagag 13866186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University