View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19631_low_44 (Length: 380)
Name: NF19631_low_44
Description: NF19631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19631_low_44 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 81; Significance: 5e-38; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 261 - 361
Target Start/End: Original strand, 12546735 - 12546835
Alignment:
| Q |
261 |
caaataaaattgacaattattaacaaagatcttaggaaaatgatattcaattcaattaagaaacagtagaaaagagcattgttacaagataaccataggt |
360 |
Q |
| |
|
||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||| ||| |
|
|
| T |
12546735 |
caaataaaattgacaattattaacaaagaacataggaaaatgatattcaattcaattaagaaacagtagaacagagcattgtcacaagataaccatgggt |
12546834 |
T |
 |
| Q |
361 |
t |
361 |
Q |
| |
|
| |
|
|
| T |
12546835 |
t |
12546835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University