View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19631_low_44 (Length: 380)

Name: NF19631_low_44
Description: NF19631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19631_low_44
NF19631_low_44
[»] chr5 (1 HSPs)
chr5 (261-361)||(12546735-12546835)


Alignment Details
Target: chr5 (Bit Score: 81; Significance: 5e-38; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 261 - 361
Target Start/End: Original strand, 12546735 - 12546835
Alignment:
261 caaataaaattgacaattattaacaaagatcttaggaaaatgatattcaattcaattaagaaacagtagaaaagagcattgttacaagataaccataggt 360  Q
    ||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||| |||    
12546735 caaataaaattgacaattattaacaaagaacataggaaaatgatattcaattcaattaagaaacagtagaacagagcattgtcacaagataaccatgggt 12546834  T
361 t 361  Q
    |    
12546835 t 12546835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University