View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19631_low_64 (Length: 301)
Name: NF19631_low_64
Description: NF19631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19631_low_64 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 138; Significance: 4e-72; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 127 - 285
Target Start/End: Complemental strand, 22447292 - 22447134
Alignment:
| Q |
127 |
ggaattgcttgagacaatgaaagtgatggaatgaggtagggccatatgggacggtggccacgtttctacatataatgaattgttatgagatttgaagcta |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22447292 |
ggaattgcttgagacaatgaaagtgatggaatgaggtagggccatatgggacggtggccacgtttctacatataatgaattgttatgagatttgaagcta |
22447193 |
T |
|
| Q |
227 |
gtgataaaacataactatgattgcaaatannnnnnnctattacctaagatagtagaatt |
285 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
22447192 |
gtgataaaacataactatgattgcaaatatttttttctattacctaagatagtagaatt |
22447134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 9 - 60
Target Start/End: Complemental strand, 22447410 - 22447359
Alignment:
| Q |
9 |
catcatcatatatgtgatatgtcttgctatatatatgtcaatagtttacatc |
60 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22447410 |
catcatcatatatgtgatatgtcttgctatatatatgtcaatagtttacatc |
22447359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University