View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19631_low_68 (Length: 295)
Name: NF19631_low_68
Description: NF19631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19631_low_68 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 14 - 278
Target Start/End: Complemental strand, 52164841 - 52164577
Alignment:
| Q |
14 |
aaatcaaattatgcaatccaacccaaaaccaccattcctattcttatatctcatcctattgtttttctttctaccttctttatcatctaccatcacccat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||| || |||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
52164841 |
aaatcaaattatgcaatccaacccaaaaccaccatttctattcttatatctcatccttttttttttctttctaccatgtttatcatctaccatcacccat |
52164742 |
T |
 |
| Q |
114 |
caattcaaagaagctcctgaattctacaattccccgaaatgcccttccattaccgacacttcaaaatcaacagtagtccaagtagcaatgacactcgaca |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52164741 |
caattcaaagaagctcctgaattctacaattccccaaaatgcccttccattaccgacacttcaaaatcaacagtagtccaagtagcaatgacactcgaca |
52164642 |
T |
 |
| Q |
214 |
caacatatatccgaggatccatggctgcaatcttatcaatcctccaacattcatcatgtccacaa |
278 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52164641 |
caacatatatccgaggatccatggcagcaatcttatcaatcctccaacattcatcatgtccacaa |
52164577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 188 - 278
Target Start/End: Complemental strand, 6635775 - 6635685
Alignment:
| Q |
188 |
agtccaagtagcaatgacactcgacacaacatatatccgaggatccatggctgcaatcttatcaatcctccaacattcatcatgtccacaa |
278 |
Q |
| |
|
|||||| || ||||||||| | |||||||||||||||||||||||||||||||||||| | || |||||||||| ||||||||||||||| |
|
|
| T |
6635775 |
agtccatgtggcaatgacattagacacaacatatatccgaggatccatggctgcaatcctctctgtcctccaacactcatcatgtccacaa |
6635685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University