View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19631_low_80 (Length: 278)
Name: NF19631_low_80
Description: NF19631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19631_low_80 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 126; Significance: 5e-65; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 14 - 147
Target Start/End: Complemental strand, 4015719 - 4015586
Alignment:
| Q |
14 |
agacacgaaacccttcgctcttaacaataatcacgaagaacacaatctgtattccgggatatcacgttgaacataaggaagaattcagcatcgttagaca |
113 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4015719 |
agacacgaaactcttcgctcttaaaaataatcacgaagaacacaatctgtattccgggatatcacgttgaacataaggaagaattcagcatcgttagaca |
4015620 |
T |
|
| Q |
114 |
ccctatacatcgtgtattccaaaaccattccttc |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
4015619 |
ccctatacatcgtgtattccaaaaccattccttc |
4015586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 153 - 239
Target Start/End: Complemental strand, 4015520 - 4015434
Alignment:
| Q |
153 |
gatagttgattcctgtaatggattgcttcttttggaagttgtttctaaaactgtttatggttttgagtactggctctgtgtttggaa |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4015520 |
gatagttgattcctgtaatggattgcttcttttggaagttgtttctgaaactgtttatggttttgagtactggctctgtgtttggaa |
4015434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University