View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19631_low_84 (Length: 265)
Name: NF19631_low_84
Description: NF19631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19631_low_84 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 18 - 255
Target Start/End: Original strand, 31263903 - 31264137
Alignment:
| Q |
18 |
agtgtcgtgatgggtattgtggtggtggtgatgggaaaacatcgtctagatactccttatgcgcaacaggtgtaggctcaaccacttatgaggagtttga |
117 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31263903 |
agtgtcgtgatggttattgtggtggtg---atgggaaaacatcgtctagatactccttatgcgcaacaggtgtaggctcaaccacttatgaggagtttga |
31263999 |
T |
 |
| Q |
118 |
ctcatcgnnnnnnngagtctgatgcctacgtcagtcccgtttagggggaggattaactgcatcatttaccttacatacaaagttatgttggctctaccta |
217 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
31264000 |
ctcatcgtcgttttgagtcagatgcctacgtcagtcccgtttagggggaggattaactgcatcatttgccttacatacaaagttatgttgactctaccta |
31264099 |
T |
 |
| Q |
218 |
ccgagtagaagcctaccaacgtcgttagaattatctac |
255 |
Q |
| |
|
|||||| ||||||||||||| |||| ||| ||||||| |
|
|
| T |
31264100 |
ccgagtcgaagcctaccaacatcgtcagatatatctac |
31264137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University