View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19631_low_96 (Length: 246)
Name: NF19631_low_96
Description: NF19631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19631_low_96 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 17 - 246
Target Start/End: Original strand, 21971029 - 21971261
Alignment:
| Q |
17 |
acatagctgatagagttgcaaatagctttgtcatgtttcttggacaacaaggtaaaggtgttttgtaacctgccggagatatctccggtgccggcagaac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21971029 |
acatagctgatagagttgcaaatagctttgtcatgtttcttggacaacaaggtaaaggtgttttgtaacctgccggagatatctccggtgccggcagaac |
21971128 |
T |
 |
| Q |
117 |
aaaggcacaaattgctgattttgttacccattggatagtgc---aatgcaatcaaagttgctttgaactttatgtgtagtaatgttgctatcttattcaa |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21971129 |
aaaggcacaaattgctgattttgttacccattggatagtgcaataatgcaatcaaagttgttttgaactttatgtgtagtaatgttgctatcttattcaa |
21971228 |
T |
 |
| Q |
214 |
agttcaaaaatgaatagagttgactttttgcat |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
21971229 |
agttcaaaaatgaatagagttgactttttgcat |
21971261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University