View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19631_low_99 (Length: 241)

Name: NF19631_low_99
Description: NF19631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19631_low_99
NF19631_low_99
[»] chr7 (1 HSPs)
chr7 (1-223)||(34832149-34832358)


Alignment Details
Target: chr7 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 34832149 - 34832358
Alignment:
1 tgtttgcattatataatgaaattactttttaatccttcctgcgcaactatcactatacttggaagaagtgaggtttagcatggttgaaagttgattgaaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||             |||||||| |||||||||||    
34832149 tgtttgcattatataatgaaattactttttaatccttcctgcgcaaccatcactatacttggaagaa-------------tggttgaaggttgattgaaa 34832235  T
101 agatttaaaaactagtaatttttatggattggaagatcaaaatttatcattgatatgataatgttggaaagctaattcatgtaccgatgcacttgcaaat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
34832236 agatttaaaaactagtaatttttatggattggaagatcaaaatttatcattgatatgatcatgttggaaagctaattcatgtaccgatgcacttgcaaat 34832335  T
201 atggattgtgagtatgatccccc 223  Q
    |||| ||||||||||| ||||||    
34832336 atgggttgtgagtatggtccccc 34832358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University