View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19633_low_12 (Length: 249)

Name: NF19633_low_12
Description: NF19633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19633_low_12
NF19633_low_12
[»] chr6 (1 HSPs)
chr6 (113-235)||(5997859-5997981)


Alignment Details
Target: chr6 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 113 - 235
Target Start/End: Original strand, 5997859 - 5997981
Alignment:
113 aaatttggtattctctgtcttttcttgtcgatggttgcccttagtgttacggtgttccagaactgaagaggcacattggactcactgaagaaaattcttt 212  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
5997859 aaatttggtattctctgtcttttctcgtcgatggttgcccttagtgttacggtgttccagaactgaaggggcacattggactcactgaagaaaattcttt 5997958  T
213 ccttgtttatggccccccttagt 235  Q
    |||||||||||||||||||||||    
5997959 ccttgtttatggccccccttagt 5997981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University