View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19633_low_22 (Length: 203)
Name: NF19633_low_22
Description: NF19633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19633_low_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 156; Significance: 4e-83; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 17 - 186
Target Start/End: Original strand, 934429 - 934595
Alignment:
| Q |
17 |
aacagccaatagagggctgctcggtccttctgtaggtgttgtggatattggtattagtaaagtggcatatctatttcgagtttccttaccaggtgtcaag |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
934429 |
aacagccaatagagggctgctcggtccttctgtaggtgttgtggatattggtattagtaaagtggcatatctatttcgagtttccttaccaggtgtcaag |
934528 |
T |
 |
| Q |
117 |
agagagtacagtacgtttctcgtctttctatttattagtcaagtttcttattccagttttatcattatct |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
934529 |
agagagtacagtacgtttctcgtctttctat---ttagtcaagtttcttattccagttttatcattatct |
934595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 18 - 145
Target Start/End: Original strand, 33957875 - 33958002
Alignment:
| Q |
18 |
acagccaatagagggctgctcggtccttctgtaggtgttgtggatattggtattagtaaagtggcatatctatttcgagtttccttaccaggtgtcaaga |
117 |
Q |
| |
|
||||||||||||||||| || ||||| || || |||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
33957875 |
acagccaatagagggctacttggtccgtcggttggtgttgtggatattggtattagtgaagtggcatatctatttcgagttttggtaccaggtgtcaaga |
33957974 |
T |
 |
| Q |
118 |
gagagtacagtacgtttctcgtctttct |
145 |
Q |
| |
|
||||| |||||| ||||||| ||||||| |
|
|
| T |
33957975 |
gagagcacagtatgtttctcttctttct |
33958002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University