View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19635_high_12 (Length: 263)
Name: NF19635_high_12
Description: NF19635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19635_high_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 13 - 247
Target Start/End: Original strand, 49846735 - 49846964
Alignment:
| Q |
13 |
aaaatatagccaagaatatttgttagtcagtttcttcattgtcaagcttttagaaatatgccatcactgcaaaatagtaccaaggatgagagttggaatt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49846735 |
aaaatatagccaagaatatttgttagtcagtttcttcattgtcaagcttttagaaatatgccatcactgcaaaatagtaccaaggatgagagttggaatt |
49846834 |
T |
 |
| Q |
113 |
ggaatgcaatcttaaatgacacaagattccctccttatgattgcaacaggaaacaagaaggctgctctgctagattggaaatgaagagataccaactaca |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
49846835 |
ggaatgcaatcttaaatgacacaagattccctccttatgattccaacaggaaacaagaagg-----ctgctagattggaaatgaagagataccaactaca |
49846929 |
T |
 |
| Q |
213 |
actaacaaattgcttaagtctgtgagtgagaattg |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
49846930 |
actaacaaattgcttaagtctgtgagtgagaattg |
49846964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University