View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19636_low_13 (Length: 244)

Name: NF19636_low_13
Description: NF19636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19636_low_13
NF19636_low_13
[»] chr1 (1 HSPs)
chr1 (37-202)||(1432214-1432379)


Alignment Details
Target: chr1 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 37 - 202
Target Start/End: Original strand, 1432214 - 1432379
Alignment:
37 ggcatgcattagtttcttattctttctcgttttcttctttgggattgttccagctgaatattagtaatgcaatcgagtatattggtccgttacaagtact 136  Q
    ||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
1432214 ggcatgcgttagtttcttattctttctcgttttcttcgttgggattgttccagctgaatattagtaatgcaatcgagtatattggtctgttacaagtact 1432313  T
137 agcaatccaattaacgggcgtttggaagggtggaagggtttattagggcttatcttacgatatttg 202  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1432314 agcaatccaattaacgggcgtttggaagggtggaagggtttattagggcttatcttacgatatttg 1432379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University