View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19636_low_13 (Length: 244)
Name: NF19636_low_13
Description: NF19636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19636_low_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 37 - 202
Target Start/End: Original strand, 1432214 - 1432379
Alignment:
| Q |
37 |
ggcatgcattagtttcttattctttctcgttttcttctttgggattgttccagctgaatattagtaatgcaatcgagtatattggtccgttacaagtact |
136 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
1432214 |
ggcatgcgttagtttcttattctttctcgttttcttcgttgggattgttccagctgaatattagtaatgcaatcgagtatattggtctgttacaagtact |
1432313 |
T |
|
| Q |
137 |
agcaatccaattaacgggcgtttggaagggtggaagggtttattagggcttatcttacgatatttg |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1432314 |
agcaatccaattaacgggcgtttggaagggtggaagggtttattagggcttatcttacgatatttg |
1432379 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University