View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19638_high_15 (Length: 237)
Name: NF19638_high_15
Description: NF19638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19638_high_15 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 16 - 237
Target Start/End: Original strand, 40389090 - 40389311
Alignment:
| Q |
16 |
gctttatctggcaaatattaactatagaaaatttaaatgcataaacatcacttacaagctgttaatgtaaggttcagtattcttttaataccgaagtact |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
40389090 |
gctttatctggcaaatattaactatagaaaaattaaatgcataaacatcacttacaagctgttaatgtaaggttcagtattctcttaataccgaagtact |
40389189 |
T |
 |
| Q |
116 |
aaattgacactagaaaaatgttataatctaatggtagaaacaatatcatttatgcaatgtacgtcataagcagtaattatggctgtgaannnnnnnngtt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||| |
|
|
| T |
40389190 |
aaattgacactagaaaaatgttataatctaatggtagaaacaatatcatttatgcaatgtacgtcataagcagtaattatggctgtcaattttttttgtt |
40389289 |
T |
 |
| Q |
216 |
gactaatttatcaaagttagtc |
237 |
Q |
| |
|
|||||||||||| ||||||||| |
|
|
| T |
40389290 |
gactaatttatctaagttagtc |
40389311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University