View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19638_low_16 (Length: 249)
Name: NF19638_low_16
Description: NF19638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19638_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 129; Significance: 7e-67; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 6 - 138
Target Start/End: Original strand, 9581019 - 9581151
Alignment:
| Q |
6 |
aggagcacagaatggtttacgtatcctggtgtttggacaacatatattctcatcctcttcttttcatggatcatggttttgtctgtctttggttgttctc |
105 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9581019 |
aggaacacagaatggtttacgtatcctggtgtttggacaacatatattctcatcctcttcttttcatggatcatggttttgtctgtctttggttgttctc |
9581118 |
T |
 |
| Q |
106 |
ctgggattgcttggactattgttaatctcgctc |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
9581119 |
ctgggattgcttggactattgttaatctcgctc |
9581151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University