View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19639_high_2 (Length: 396)
Name: NF19639_high_2
Description: NF19639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19639_high_2 |
 |  |
|
| [»] scaffold0077 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0077 (Bit Score: 380; Significance: 0; HSPs: 1)
Name: scaffold0077
Description:
Target: scaffold0077; HSP #1
Raw Score: 380; E-Value: 0
Query Start/End: Original strand, 1 - 384
Target Start/End: Complemental strand, 10719 - 10336
Alignment:
| Q |
1 |
aaccgtttcatcatcaacgtaacaacgttgatgacggtgatggtgaagcgagcgacgttgaagctgaaggcagccccgatgacgagtgaggtaaagtcac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
10719 |
aaccgtttcatcatcaacgtaacaacgttgatgacggtgatggtgaagcgagcgacgttgaagctgaaggcggccccgatgacgagtgaggtaaagtcac |
10620 |
T |
 |
| Q |
101 |
ctaagaagttgctgaaaaacataagcaacaaagctatgccgtttattgagaagatgaagaagaaaaagaaagggaagttggagtggggtgatggtggtgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10619 |
ctaagaagttgctgaaaaacataagcaacaaagctatgccgtttattgagaagatgaagaagaaaaagaaagggaagttggagtggggtgatggtggtgt |
10520 |
T |
 |
| Q |
201 |
ttggcagaaaacgatcttgatgggtgataagtgtgaaccgttggatttctctggtgtgatttattatgacaataaggggaaacaggtgaatgaatttcct |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10519 |
ttggcagaaaacgatcttgatgggtgataagtgtgaaccgttggatttctctggtgtgatttattatgacaataaggggaaacaggtgaatgaatttcct |
10420 |
T |
 |
| Q |
301 |
ctcaggtcgccacgtgccactcccgtgcctggttttttcatcggacagaaggtacagtgagttttgttttggtcgttggatttt |
384 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10419 |
ctcaggtcgccacgtgccactcccgtgcctggttttttcatcggacagaaggtacagtgagttttgttttggtcgttggatttt |
10336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 199 - 285
Target Start/End: Complemental strand, 46221359 - 46221273
Alignment:
| Q |
199 |
gtttggcagaaaacgatcttgatgggtgataagtgtgaaccgttggatttctctggtgtgatttattatgacaataaggggaaacag |
285 |
Q |
| |
|
||||||||||| ||| |||||||| | |||||||| |||||||||||||| ||||||||||| || || | ||| ||||||||| |
|
|
| T |
46221359 |
gtttggcagaaggagattttgatgggaggaaagtgtgagccgttggatttctccggtgtgatttactacgatattaacgggaaacag |
46221273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University