View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19639_high_6 (Length: 248)
Name: NF19639_high_6
Description: NF19639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19639_high_6 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 19 - 248
Target Start/End: Complemental strand, 47533486 - 47533257
Alignment:
| Q |
19 |
gtgcatgctcaaagagaaaaagttgctacatagtttttgggtgaaaaagttgctacgtatatatatcaaaacaaacacctgactatgtttccacacagtt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
47533486 |
gtgcatgctcaaagagaaaaagttgctacatagtttttgggtgaaaaagttgctacgtatatatatcaaaacaaacacctgactatgttcccacacagtt |
47533387 |
T |
 |
| Q |
119 |
ggtagtttgggtccgggggattctcggttgcgaagaaaagaagctcttattggaaaataaattaatgcagatcaatttactccatgagcagaagaagcct |
218 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||| | |
|
|
| T |
47533386 |
ggtagtttgggtccaggggattctcggttgcgaagaaaagaagctcttattggaaaataaattaatgcagatcagtttactccatgagcagaagtagctt |
47533287 |
T |
 |
| Q |
219 |
aactgttgaaccacaaatactaacagaccc |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
47533286 |
aactgttgaaccacaaatactaacagaccc |
47533257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University