View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19639_low_8 (Length: 239)

Name: NF19639_low_8
Description: NF19639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19639_low_8
NF19639_low_8
[»] chr5 (1 HSPs)
chr5 (15-239)||(12956412-12956636)


Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 15 - 239
Target Start/End: Original strand, 12956412 - 12956636
Alignment:
15 atcatccaatgcctagtattccttcaccacatggaaatggccctccccttttaccttctccaacctctcaatttctcttgccttctccaactggttacat 114  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12956412 atcatccaatgcctagtattccttcaccgcatggaaatggccctccccttttaccttctccaacctctcaatttctcttgccttctccaactggttacat 12956511  T
115 gaatttactgtcccctcggtcaccttatccactattgtcacccggctttcagttaccatcaccactacccaatttttcgttctcacccatggcacagtca 214  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||| |||||||    
12956512 gaatttactgtcccctcggtcaccttatccactattgtcacccggctttcagtttccatcaccactacccaattttccgttctcacccatgggacagtca 12956611  T
215 ggaattttagggcctggccctcaac 239  Q
    |||||||||||||||||||||||||    
12956612 ggaattttagggcctggccctcaac 12956636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University