View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1963R-Insertion-4 (Length: 98)

Name: NF1963R-Insertion-4
Description: NF1963R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1963R-Insertion-4
NF1963R-Insertion-4
[»] chr5 (1 HSPs)
chr5 (9-38)||(29199429-29199458)
[»] chr4 (1 HSPs)
chr4 (9-38)||(12652447-12652476)


Alignment Details
Target: chr5 (Bit Score: 30; Significance: 0.00000003; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000003
Query Start/End: Original strand, 9 - 38
Target Start/End: Original strand, 29199429 - 29199458
Alignment:
9 ccttccataactgaaaatcaaatcccgctt 38  Q
    ||||||||||||||||||||||||||||||    
29199429 ccttccataactgaaaatcaaatcccgctt 29199458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 30; Significance: 0.00000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000003
Query Start/End: Original strand, 9 - 38
Target Start/End: Complemental strand, 12652476 - 12652447
Alignment:
9 ccttccataactgaaaatcaaatcccgctt 38  Q
    ||||||||||||||||||||||||||||||    
12652476 ccttccataactgaaaatcaaatcccgctt 12652447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University