View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1963R-Insertion-5 (Length: 126)
Name: NF1963R-Insertion-5
Description: NF1963R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1963R-Insertion-5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 56; Significance: 1e-23; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 56; E-Value: 1e-23
Query Start/End: Original strand, 5 - 76
Target Start/End: Original strand, 5284257 - 5284328
Alignment:
| Q |
5 |
atcacctgcattggaagcttttctagctcccgttgaattaagcgacgttgctttggttcaaacgattgtaac |
76 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
5284257 |
atcacctacattggaagcttttctagctcccgttgatttaagcgacgttgctttggttcaaacccttgtaac |
5284328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University