View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1963_high_3 (Length: 310)
Name: NF1963_high_3
Description: NF1963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1963_high_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 14 - 295
Target Start/End: Complemental strand, 42799454 - 42799173
Alignment:
| Q |
14 |
acatcatcacacaacccgccgtgattcatatgttggcagaatgtgctggacttcaatggttcgaaagttggggaaccaaggaactatctgatgttggtct |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42799454 |
acatcatcacacaacccgccgtgattcatatgttggcagaatgtgccggacttcaatggttcgaaagttggggaaccaaggaactatctgatgttggtct |
42799355 |
T |
 |
| Q |
114 |
tccccttgtgacaccaaaacagatcatcaaggtgtgtactatatcatataagctctcattgcattgaaccttgtcaagtatgaattctgcataactctag |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42799354 |
tccccttgtgacaccaaaacagatcatcaaggtgtgtactatatcatataagctctcattgcattgaaccttgtcaagtatgaattctgcataactctag |
42799255 |
T |
 |
| Q |
214 |
tgcatacagagtaaaatgctatcttgcatttcttaaatgtgtgtgcatatatggaaaatgcttcaaaatagttatttcattt |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42799254 |
tgcatacagagtaaaatgctatcttgcatttcttaaatgtgtgtgcatatatggaaaatgcttcaaaatagttatttcattt |
42799173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University