View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1963_low_3 (Length: 367)
Name: NF1963_low_3
Description: NF1963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1963_low_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 319; Significance: 1e-180; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 19 - 345
Target Start/End: Original strand, 29238522 - 29238848
Alignment:
| Q |
19 |
gccaccatcgacatgagcaccagcagcaaacccatagaaatcggttataagtttaccaatttcgacaatctgttcgaagacatggttagggatagggtta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29238522 |
gccaccatcgacatgagcaccagcagcaaacccatagaaatcggttataagtttaccaatttcgacaatctgttcgaagacatggttagggatagggtta |
29238621 |
T |
 |
| Q |
119 |
agaagcatctcaatgttaatcttcttgtcatagtaattaacaacatcatttttgagaatttcaagtatcttatcagccacgaatctgacagtactgagcg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29238622 |
agaagcatctcaatgttaatcttcttgtcatagtaattaacagcatcatttttgagaatttcaagtatcttatcagccacgaatctgacagtactgagcg |
29238721 |
T |
 |
| Q |
219 |
gctgaccggcaagaggctgaccagggcgtggctgctggataagagtgagcagattgttgtaggccgcgcgggttttgttacttttaggttggtagaggcc |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29238722 |
gctgaccggcaagaggctgaccagggcgtggctgctggataagagtgagcagattgttgtaggccgcgcgggttttgttagttttaggttggtagaggcc |
29238821 |
T |
 |
| Q |
319 |
gtcgtcgacgaccgggaagacgaactt |
345 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
29238822 |
gtcgtcgacgaccgggaagacgaactt |
29238848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University