View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1963_low_5 (Length: 307)
Name: NF1963_low_5
Description: NF1963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1963_low_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 11 - 243
Target Start/End: Original strand, 42225209 - 42225441
Alignment:
| Q |
11 |
atgaaccccaccatcatatgttcatcaactggtatatataaatataatgatgaaatggtatttcagtgaacataattatatggnnnnnnnnnnnnnnnnn |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
42225209 |
atgaaccccaccatcatatgttcatcaactggtatatataa------tgatgaaatggtatttcagtgaacataattatatggtttttctttttttcttt |
42225302 |
T |
|
| Q |
111 |
----acaaaaacataattgtaggtcaatatgctttt--ctctctctcaaaatactcataacatttttgttagtattatccatgttggaacgtgacacatt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42225303 |
ttatacaaaaacataattgtaggtcaatatgcttttttctctctctcaaaatactcataacatttttgttagtattatccatgttggaacgtgacacatt |
42225402 |
T |
|
| Q |
205 |
tttgtcttataactttggaaatatcttatttgtttcttt |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42225403 |
tttgtcttataactttggaaatatcttatttgtttcttt |
42225441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University