View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1963_low_7 (Length: 302)
Name: NF1963_low_7
Description: NF1963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1963_low_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 16 - 279
Target Start/End: Complemental strand, 29239136 - 29238873
Alignment:
| Q |
16 |
atgacattgtccatttaattttagcaaaatcagaggacctaacttagatatgttagcccttgatcgactatttaagctaatagtgtttaacttttttaca |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
29239136 |
atgacattgtccatttaattttagcaaaatcagaggacctaacttagatattttagcccttgatcgactatttaagcaaatagtgtgtaacttttttaca |
29239037 |
T |
|
| Q |
116 |
attagggttcttcttgaatcgcctcggtgtttccaaacatggcagactcgcggttcaaccaatacaactacaccggtgcacatctagtcttcttccctcc |
215 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29239036 |
attagggttcttcttgaaccgcctcggtgtttccaaacatggcagactcgcggttcaaccaatacaactacaccggtgcacatctagtcttcttccctcc |
29238937 |
T |
|
| Q |
216 |
cgctcgcgaaatccccataccaaacgctgaaccacgacgccgtaggtatcaaattcacatgatc |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29238936 |
cgctcgcgaaatccccataccaaacgctgaaccacgacgccgtaggtatcaaattcacatgatc |
29238873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University