View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19640_high_6 (Length: 250)

Name: NF19640_high_6
Description: NF19640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19640_high_6
NF19640_high_6
[»] chr8 (2 HSPs)
chr8 (40-250)||(1966802-1967012)
chr8 (47-250)||(2009865-2010068)


Alignment Details
Target: chr8 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 40 - 250
Target Start/End: Original strand, 1966802 - 1967012
Alignment:
40 gagccgtttccagagcagccaaacttggtctaattgaatctttgttagctgtaactggggctatttagccgttttgatgtcaaaacacattgattattcg 139  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1966802 gagccgattccagagcagccaaacttggtctaattgaatctttgttagctgtaactggggctatttagccgttttgatgtcaaaacacattgattattcg 1966901  T
140 gcatcattgattatatttcatctttcggttgggcgcgataactagtttcaagggagcggggtcaagagagaggaggcgtatgagcacaaccgaaacagtc 239  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1966902 gcatcattgattatatttcatctttcggttggacgcgataactagtttcaagggagcggggtcaagagagaggaggcgtatgagcacaaccgaaacagtc 1967001  T
240 gcataacatga 250  Q
    | |||||||||    
1967002 ggataacatga 1967012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 47 - 250
Target Start/End: Complemental strand, 2010068 - 2009865
Alignment:
47 ttccagagcagccaaacttggtctaattgaatctttgttagctgtaactggggctatttagccgttttgatgtcaaaacacattgattattcggcatcat 146  Q
    ||||||||||||| ||||  ||||| |||||| |||| ||||||||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||    
2010068 ttccagagcagccgaactcagtctagttgaatatttggtagctgtaactggggctatttagccgttttggtgtcaaaacatattgattattcggaatcat 2009969  T
147 tgattatatttcatctttcggttgggcgcgataactagtttcaagggagcggggtcaagagagaggaggcgtatgagcacaaccgaaacagtcgcataac 246  Q
    |||||||||||||||||| ||||||||| |||||||| ||||||||||||||| ||||||||| ||||||| |||||||||||   ||||||| || |||    
2009968 tgattatatttcatctttaggttgggcgtgataactaatttcaagggagcgggatcaagagagtggaggcgcatgagcacaactagaacagtctcagaac 2009869  T
247 atga 250  Q
    ||||    
2009868 atga 2009865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University