View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19641_low_6 (Length: 281)
Name: NF19641_low_6
Description: NF19641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19641_low_6 |
 | |
|
| [»] scaffold0190 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0190 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: scaffold0190
Description:
Target: scaffold0190; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 29 - 275
Target Start/End: Complemental strand, 12583 - 12337
Alignment:
| Q |
29 |
agctcaaccaaaggatcccatgtcccctcctttcaagggttttccctcaacaggcaacccaaagtaagtaaaggggataaaatcttctctacaatagagg |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12583 |
agctcaaccaaaggatcccatgtcccctcctttcaagggttttccctcaacaggcaacccaaagtaagtaaaggggataaaatcttctctacaatagagg |
12484 |
T |
|
| Q |
129 |
aaactctcaaccctcagtcatactnnnnnnntatggatgcacatgaacacacataatactactctttgcaatgttaactcgaagaccagatgctagacca |
228 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12483 |
aaactctcaaccctcagtcatactaaaaaaatatggatgcacatgaacacacataatactactctttgcaatgttaactcgaagaccagatgctagacca |
12384 |
T |
|
| Q |
229 |
aaccagcaaagaaatgttttaatggtccatagattgtcctatgcttc |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12383 |
aaccagcaaagaaatgttttaatggtccatagattgtcctatgcttc |
12337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University