View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19641_low_7 (Length: 250)
Name: NF19641_low_7
Description: NF19641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19641_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 13 - 227
Target Start/End: Original strand, 1027730 - 1027944
Alignment:
| Q |
13 |
aatatcctacttatgctggatccattaacgatttacatagatcttcaaaaccatatcctagttattctgaatatgatccagcaaattggtgctgcaatat |
112 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
1027730 |
aatatcctacttatgttggatccattaacgatttacatagatcttcaaaaccatatcctagttatcctgaatatcatccagcaaattggtgctgcaatat |
1027829 |
T |
 |
| Q |
113 |
tgtcattgcactttgttgtaattcatagtctaaagcatagcatgatgtatcgcaaaaataataagaattaaaaattcaactacatcatctcacaaagaaa |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1027830 |
tgtcattgcactttgttgtaattcatagtctaaagcaaagcatgatgtatcgcaaaaataataagaattaaaaattcaactacatcatctcacaaagaaa |
1027929 |
T |
 |
| Q |
213 |
tgaataaaactttag |
227 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
1027930 |
tgaataaaactttag |
1027944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 159 - 197
Target Start/End: Original strand, 1025525 - 1025563
Alignment:
| Q |
159 |
gtatcgcaaaaataataagaattaaaaattcaactacat |
197 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
1025525 |
gtatcgcaaaaataatcagaattaaaaattcacctacat |
1025563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University