View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19642_high_18 (Length: 228)
Name: NF19642_high_18
Description: NF19642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19642_high_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 15 - 188
Target Start/End: Original strand, 14824509 - 14824671
Alignment:
| Q |
15 |
atacttataatcacctccaattcaggtcacaaattttatatattgattgattcatcttcactcttctcttgtctttgtttcattaatcattattaatcaa |
114 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
14824509 |
atacttataatcacctc-aattcacgtcacaaattttatatattgattgattcatcttcagtcttctcttgtctttgtttcatta----------atcaa |
14824597 |
T |
 |
| Q |
115 |
ttttcacgtatgtcgttaaattcaactcatgcataatatcgatcaacaaattatttgatcgttaattttccgtc |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14824598 |
ttttcacgtatgtcgttaaattcaactcatgcataatatcgatcaacaaattatttgatcgttaattttccgtc |
14824671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University