View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19642_low_10 (Length: 307)
Name: NF19642_low_10
Description: NF19642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19642_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 16 - 290
Target Start/End: Complemental strand, 2132331 - 2132079
Alignment:
| Q |
16 |
atttacctatagaataccagtatccaaccaaactttaaagtacctaaaagtttaccataagtatttttattttcataataataaaaataaaacacaatat |
115 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||||||||||||||||||||||||| ||||||| ||||| || ||| |
|
|
| T |
2132331 |
atttacctatagaatatcactatccaaccaaactttaaagtacctaaaagtttaccataggtatttt-atttttat---------------------tat |
2132254 |
T |
|
| Q |
116 |
ttccgaaaccaaacatgtctttataattgctccatgaaagaagaagaaaacatgtctttatttacattttttcctttatggaaaaaagaagatatctttt |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
2132253 |
ttccgaaaccaaacatgtctttataattgctccatgaaagaagaagaaaacatgtctttatttacattttttcctttatggaaaaaagaagatctctttt |
2132154 |
T |
|
| Q |
216 |
tgtcaaacatttccaaagaaacgatatcttatttgtggaattttgagatgaatgcacgtgcataacatctgattt |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2132153 |
tgtcaaacatttccaaagaaacgatatcttatttgtggaattttgagatgaatgcacgtgcataacatctgattt |
2132079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University