View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19642_low_13 (Length: 250)
Name: NF19642_low_13
Description: NF19642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19642_low_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 234; Significance: 1e-129; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 25553121 - 25552884
Alignment:
| Q |
1 |
tatatcacacactataaacaaaccactctcagcagtcacatatagcatgagcatagtcaatgagattatttcccccattaaaacaacgcgattaacacgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25553121 |
tatatcacacactataaacaaaccactctcagcagtcacatatagcatgagcatagtcaatgagattatttcccccattaaaacaacgcgattaacacgc |
25553022 |
T |
|
| Q |
101 |
gaccgagcaagagacagggattcgatggagaaaatgctttgtgaaggaaaccttgtggtatgtccagaaggaacaacttgtagagaaccttacttgctaa |
200 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25553021 |
gaccgagtaagagacagggattcgatggagaaaatgctttgtgaaggaaaccttgtggtatgtccagaaggaacaacttgtagagaaccttacttgctaa |
25552922 |
T |
|
| Q |
201 |
ggtttagtcctttgtttgctgagctaactgatgatatt |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25552921 |
ggtttagtcctttgtttgctgagctaactgatgatatt |
25552884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 161 - 223
Target Start/End: Complemental strand, 39975872 - 39975810
Alignment:
| Q |
161 |
tgtccagaaggaacaacttgtagagaaccttacttgctaaggtttagtcctttgtttgctgag |
223 |
Q |
| |
|
||||| ||||||||||| ||||||||||| || ||| ||||||||||| | |||||||||||| |
|
|
| T |
39975872 |
tgtcctgaaggaacaacatgtagagaaccatatttgttaaggtttagttcattgtttgctgag |
39975810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 161 - 222
Target Start/End: Complemental strand, 38792346 - 38792285
Alignment:
| Q |
161 |
tgtccagaaggaacaacttgtagagaaccttacttgctaaggtttagtcctttgtttgctga |
222 |
Q |
| |
|
||||||||||| || ||||||||||||||||| || |||||||||| |||||||| |||| |
|
|
| T |
38792346 |
tgtccagaagggaccacttgtagagaaccttatttattaaggtttagctctttgttttctga |
38792285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University