View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19642_low_20 (Length: 226)
Name: NF19642_low_20
Description: NF19642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19642_low_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 154; Significance: 8e-82; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 50 - 207
Target Start/End: Complemental strand, 3857673 - 3857516
Alignment:
| Q |
50 |
catcacctttcacttgtatttgtgatgtgtataagccaagagagttcataggttgaaaatatttgattgcatcctcatactcaaatgactgaatggttgt |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
3857673 |
catcacctttcacttgtatttgtgatgtgtataagccaagagagttcataggttgaaaatatttgattgcatcctcatactcaaatgactgaatggctgt |
3857574 |
T |
|
| Q |
150 |
cttctcaatatttgtacattcaaactttttacaattatctttgacatgatgaattttc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3857573 |
cttctcaatatttgtacattcaaactttttacaattatctttgacatgatgaattttc |
3857516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 50 - 207
Target Start/End: Complemental strand, 3866430 - 3866273
Alignment:
| Q |
50 |
catcacctttcacttgtatttgtgatgtgtataagccaagagagttcataggttgaaaatatttgattgcatcctcatactcaaatgactgaatggttgt |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
3866430 |
catcacctttcacttgtatttgtgatgtgtataagccaagagagttcataggttgaaaatatttgattgcatcctcatactcaaatgactgaatggctgt |
3866331 |
T |
|
| Q |
150 |
cttctcaatatttgtacattcaaactttttacaattatctttgacatgatgaattttc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3866330 |
cttctcaatatttgtacattcaaactttttacaattatctttgacatgatgaattttc |
3866273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 95 - 174
Target Start/End: Original strand, 5440458 - 5440537
Alignment:
| Q |
95 |
tcataggttgaaaatatttgattgcatcctcatactcaaatgactgaatggttgtcttctcaatatttgtacattcaaac |
174 |
Q |
| |
|
|||||||| ||||| |||||||||||| |||| || ||||||| | || ||||||||| |||||||||||||||||| |
|
|
| T |
5440458 |
tcataggtggaaaagatttgattgcattctcaggctgaaatgaccggataactgtcttctctatatttgtacattcaaac |
5440537 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University