View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19643_high_12 (Length: 203)

Name: NF19643_high_12
Description: NF19643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19643_high_12
NF19643_high_12
[»] chr7 (1 HSPs)
chr7 (33-203)||(26914530-26914700)


Alignment Details
Target: chr7 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 33 - 203
Target Start/End: Original strand, 26914530 - 26914700
Alignment:
33 tcatcccagccatcctcaaggccaccctcgattataggctctcagttatacttctttaatgagatgcatatggttttaatgctctcttccttttgaacct 132  Q
    |||||| | |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26914530 tcatcctacccatcctcaaggccacccccgattataggctctcagttatacttctttaatgagatgcatatggttttaatgctctcttccttttgaacct 26914629  T
133 tttcatgttacggtgatagtaataaatgaatatccctgtgaacttaattcagttggttgaaataatgcata 203  Q
    ||| |||||||| ||||||||| |||||||| ||   ||||||||||||||||||||||| ||||||||||    
26914630 ttttatgttacgatgatagtaacaaatgaatgtcatcgtgaacttaattcagttggttgagataatgcata 26914700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University