View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19643_high_12 (Length: 203)
Name: NF19643_high_12
Description: NF19643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19643_high_12 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 33 - 203
Target Start/End: Original strand, 26914530 - 26914700
Alignment:
| Q |
33 |
tcatcccagccatcctcaaggccaccctcgattataggctctcagttatacttctttaatgagatgcatatggttttaatgctctcttccttttgaacct |
132 |
Q |
| |
|
|||||| | |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26914530 |
tcatcctacccatcctcaaggccacccccgattataggctctcagttatacttctttaatgagatgcatatggttttaatgctctcttccttttgaacct |
26914629 |
T |
 |
| Q |
133 |
tttcatgttacggtgatagtaataaatgaatatccctgtgaacttaattcagttggttgaaataatgcata |
203 |
Q |
| |
|
||| |||||||| ||||||||| |||||||| || ||||||||||||||||||||||| |||||||||| |
|
|
| T |
26914630 |
ttttatgttacgatgatagtaacaaatgaatgtcatcgtgaacttaattcagttggttgagataatgcata |
26914700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University